Genetic modification (GM) has been a hotly debated topic in recent years. And with just about any juicily contentious topic, the media doesn’t usually do a good job of accurately conveying the cold, hard facts about GM (see Science Sexified by the Media!). In many popular press articles, the prevailing message is that GM = bad, and Greenpeace probably has a lot to do with that reputation. But is that true? Let’s delve into some of the science behind the drama and find out what exactly is going on here.

The gist of GM

Also known as genetic manipulation or genetic engineering, GM uses technology to modify the characteristics of organisms by changing their genes.

Much of the current research in GM revolves around staple food crops for the global human population. With increasing pressure on the environment to supply enough food for our skyrocketing population, scientists are attempting to improve the productivity, longevity and adaptability of crop species.

By discovering which genes are responsible for characteristics such as drought tolerance and fruit yield, they can be altered or transplanted between species to produce a superior crop.

But what exactly are genes? A gene is a section of ‘coding’ DNA, meaning it contains information that is used to construct a protein out of amino acids. These proteins give rise to the many characteristics in an organism, such as drought tolerance and fruit yield in plants. The majority of our DNA actually doesn’t consist of genes. Around 95% of our entire genome codes for a big fat nothing, which scientists call ‘Junk DNA’.

DNA (deoxyribonucleic acid) is composed of a sequence of nucleotides (molecular units), each of which is made up of a sugar, a phosphate group and a nitrogenous base. These bases are adenine, cytosine, guanine and thymine – ACGT for short. Adenine pairs with thymine, and cytosine with guanine, to create DNA’s characteristic double helix structure.

In print, a gene looks something like this:

TTGATTACCTTATTTGATCATTACACATTGTACGCTTGTGTCAAAATATCACATGTGCCT…

(This is the beginning of the gene that codes for human tryptophan hydroxylase, an enzyme involved in the synthesis of serotonin.)

Think of it like a weird four letter alphabet that, when translated, creates proteins instead of words. Genes are usually many thousands of base pairs long.

How GM works

There are two main methods of genetic modification. Firstly, the order of bases in a gene can be altered in order to change the structure of the protein that it codes for. This results in the protein behaving differently, and therefore affects the way a genetically modified organism (GMO) looks, behaves or functions in some way.

Alternatively, entire genes can be transplanted from one species to another, giving the recipient new, advantageous characteristics. For example, insect-resistant cotton was created by transplanting a gene from a naturally occurring soil bacterium. As a result, Australia reduced its pesticide use by 80%.

Cause for concern?

The controversy surrounding GM arises over the potential adverse effects of GMOs on our health and environment. Some people fear that GM crops could become ‘super weeds’ and negatively affect biodiversity in natural systems.

There are also people who argue that humans have no right to change what ‘nature intended’, for our own purposes. Greenpeace has taken a particularly strong stand against GM, arguing that GM foods are detrimental to our health and environment, and that GM crops go hand-in-hand with chemical intensive agriculture.

Mixed messages

It’s easy to see why many people are confused about what GM actually means. Greenpeace’s web page outlining the key threats of genetically modified crops is a perfect example of how to misconstrue the science underlying GM. They start by stating that there are two types of GM crops; those that absorb herbicides without dying, and those that produce pesticides within the plant. Wrong and wrong.

There is a stunning variety of genetic modifications that can be applied to crops. For example, scientists aim to improve the drought tolerance of barley by manipulating recently discovered ‘stay-green’ genes. The idea that a plant ‘produces’ a pesticide is inaccurate. Insect resistant properties are introduced into GM crops by transplanting bacterial genes, like those that inhibit the digestive enzymes of herbivorous insects.

The notion that GM plants ‘absorb herbicides’ and that GM foods are ‘tainted’ and ‘unsafe’ is widely promoted by Greenpeace, but the evidence used to back up this argument is sketchy to say the least. Herbicides function by blocking critical enzymes in plants’ metabolic processes. Herbicide-resistant crops do not absorb herbicides, but are modified such that the chemicals do not affect their enzymes.

Looking at things a different way

Here’s another way of looking at the whole thing: humans have been ‘genetically modifying’ food crops since the very beginnings of agriculture; we like to call it “breeding”. It works like this: you have a number of plants, let’s say they’re wheat. Some plants produce large grains, and some produce smaller ones. You get more flour out of the larger grains, which means you can make more bread for you and your cherished ones.

So when you plant your crop next year, which seeds do you use? Over time, selective use of crops with ‘better’ characteristics modifies them, genetically. This is exactly what has happened with wheat:

So is genetic modification using technology really any different? How do you feel about GM crops feeding us into the future?